putB

putB
168

proline dehydrogenase (L-proline, FAD)

locus
BSU_03200
Molecular weight
34.89 kDa
pI
7.29
Protein length
Gene length
function
proline utilization
product
proline dehydrogenase (L-proline, FAD)
essential
no
ec
1.5.99.8
synonyms
putB, ycgM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0506

This gene is a member of the following regulons

Gene
Coordinates
344,551  345,462
Phenotypes of a mutant
no growth with proline as single source of carbon or nitrogen [Pubmed|21840319]
inactivation of ''[gene|1F548515402950572E7212901729B2480432D1B9|putB]'' eliminates sporulation [Pubmed|26735940]
The protein
Catalyzed reaction/ biological activity
quinone + L-proline --> (S)-1-pyrroline-5-carboxylate + quinol + H+ (according to UniProt)
Protein family
proline dehydrogenase family (with [protein|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|fadM], according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|4H6Q] (from ''Deinococcus radiodurans '', 42% identity) [Pubmed|23151026]
[AF|P94390]
Paralogous protein(s)
[protein|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|fadM]
Expression and Regulation
Operons
genes
[gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]
description
[Pubmed|21840319,22139509]
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]: activation, [Pubmed|21840319,21964733,22139509], in [regulon|protein:C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR regulon]
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, displacement of [protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR] [Pubmed|21840319], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21840319,21964733,22139509], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
overexpressed in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [PubMed|14976255]
the [gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP] part of the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Open in new tab

[gene|1F548515402950572E7212901729B2480432D1B9|putB]→[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]

2022-11-30 15:57:13

Jstuelk

39

d991744c53f7fc7228712ba483de8c17cc05c88a

72CAEF916BFA077D3E9623FC66EECF026978B0D8

Biological materials
Mutant
GP3904 (''[gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]''::''aphA3''), available in [wiki|Jörg Stülke]'s lab
MGNA-B992 (ycgM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1991 NBRP B. subtilis, Japan]
BKE03200 ([gene|1F548515402950572E7212901729B2480432D1B9|putB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTCCAACCTCAACACCC,  downstream forward: _UP4_AAGAAGTAAAAAAGGAGAGA
BKK03200 ([gene|1F548515402950572E7212901729B2480432D1B9|putB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTCCAACCTCAACACCC,  downstream forward: _UP4_AAGAAGTAAAAAAGGAGAGA
Expression vectors
pGP3732: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
References
14976255,21840319,14651647,12618455,23033921,21964733,22139509,23151026,26735940

1F548515402950572E7212901729B2480432D1B9

Page visits: 3357

Time of last update: 2022-12-04 04:05:04

Author of last update: Robert.warneke