ydiF

ydiF
168

similar to [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_05950
Molecular weight
73.27 kDa
pI
4.87
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
ydiF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0488

This gene is a member of the following regulons

Gene
Coordinates
644,528  646,456
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|ABCF ATPase subfamily] [pubmed|30597160]
[wiki|Domains]
2 [wiki|ABC transporter domain]s (aa 4-259, aa 327-541) (according to UniProt)
Structure
[PDB|3J5S] (EttA from E. coli, 34% identity) [pubmed|24389465]
[PDB|4FIN] (EttA from E. coli, 34% identity) [pubmed|24389466]
[AF|O05519]
Paralogous protein(s)
[protein|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA], [protein|47B644F334A0BD501E77A198A61CE0F22BAB3E5E|yfmM], [protein|F69F15198ACF8A8347C450EEC09F000EECEDEC41|yfmR]
Expression and Regulation
Operons
genes
[gene|1F56D3275386BB54A774BFA045C09E36D1268471|ydiF]
description
[pubmed|22383849]
Open in new tab

[gene|1F56D3275386BB54A774BFA045C09E36D1268471|ydiF]

2022-11-15 20:25:26

Jstuelk

14

0e1671a4ec0a0d343d7eda88b297bb768ca995b7

EEF13E79EC5AC6E4AC5A955C0EE431756A4B4FA2

Biological materials
Mutant
MGNA-C199 (ydiF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2197 NBRP B. subtilis, Japan]
BKE05950 ([gene|1F56D3275386BB54A774BFA045C09E36D1268471|ydiF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTATTTCACCTCTGCT,  downstream forward: _UP4_TAAAAAAGTCAAGCACCTCT
BKK05950 ([gene|1F56D3275386BB54A774BFA045C09E36D1268471|ydiF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTATTTCACCTCTGCT,  downstream forward: _UP4_TAAAAAAGTCAAGCACCTCT
References
Reviews
30746819,24500425
Original Publications
10092453,20525796,24389466,24389465,27006457

1F56D3275386BB54A774BFA045C09E36D1268471

Page visits: 1286

Time of last update: 2022-11-28 20:15:01

Author of last update: Melvin.boenninger