ganR

ganR
168

transcriptional repressor of the galactan utilization operon

locus
BSU_34170
Molecular weight
37.31 kDa
pI
5.4
Protein length
Gene length
function
regulation of galactan utilization
product
transcriptional repressor ([wiki|LacI family])
essential
no
synonyms
lacR, yvfJ, ganR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1609

This gene is a member of the following regulons

Gene
Coordinates
3,508,659  3,509,651
The protein
Protein family
[wiki|LacI family]
[wiki|Domains]
[wiki|HTH lacI-type domain] (aa 2-57) (according to UniProt)
Structure
[PDB|2HSG] (B. megaterium [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA], 25% identity) [pubmed|17500051]
[AF|O07008]
Effectors of protein activity
released from DNA upon binding of galactobiose [pubmed|22383849,27501980]
Expression and Regulation
Operons
genes
[gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]
description
[Pubmed|22383849]
regulation
induced by galactan (binding of galactobiose to [protein|1F787F70C87DEB221709579122D63C2322A84E56|ganR]) [Pubmed|28617843]
regulatory mechanism
[protein|1F787F70C87DEB221709579122D63C2322A84E56|ganR]: repression, [pubmed|22383849], in [regulon|protein:1F787F70C87DEB221709579122D63C2322A84E56|ganR regulon]
Open in new tab

[gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]

2022-09-08 02:40:27

Jstuelk

15

f18e3bfeeb8c03bb6051a42cae979fa661fb9f80

AFC0318A8F4F222C9056F7E1BE2132050277CD77

Biological materials
Mutant
GP815 ([gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]::spc) available in [wiki|Jörg Stülke]'s lab
BKE34170 ([gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTATCTGCCTCCATTA,  downstream forward: _UP4_TAAGGATGACTTAGGACACT
BKK34170 ([gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTATCTGCCTCCATTA,  downstream forward: _UP4_TAAGGATGACTTAGGACACT
References
2104611,9287030,27501980,22383849,17500051

1F787F70C87DEB221709579122D63C2322A84E56

Page visits: 3542

Time of last update: 2022-09-28 02:02:07

Author of last update: Melvin.boenninger