rapF

rapF
168

response regulator aspartate phosphatase, anti-activator protein, controls [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] activity

locus
BSU_37460
Molecular weight
45.45 kDa
pI
5.18
Protein length
Gene length
function
control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] activity
product
response regulator aspartate phosphatase
essential
no
synonyms
rapF, ywhJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,846,001  3,847,146
The protein
Catalyzed reaction/ biological activity
control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] activity [Pubmed|15968044]
Protein family
[wiki|RAP family] (according to UniProt)
[wiki|Domains]
six [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[PDB|3ULQ] (structure of the complex between the DNA-binding C-terminal domain of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] with [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]) [Pubmed|22215984]
[AF|P71002]
Effectors of protein activity
binding of [protein|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF] to [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF] results in a conformational change of [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF] and prevents it from binding [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] [Pubmed|15968044,22215984]
Expression and Regulation
Operons
genes
[gene|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]-[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]
description
[Pubmed|11466295]
regulation
PhrF accumulates at high cell density
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, [Pubmed|15968044], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
sigma factors
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|11466295], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]→[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]

2022-09-24 18:39:24

ghost

24

caaf58cf3ca24000725b4e5af0da77551dda5a5a

010F63D4BF5DE15B6446EA3923DABA1AD5BB01DD

Biological materials
Mutant
MGNA-A035 (rapF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/35 NBRP B. subtilis, Japan]
BKE37460 ([gene|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTTGCAAATCCCTCCC,  downstream forward: _UP4_CTTATTCAAGGAGGAGTGAG
BKK37460 ([gene|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTTGCAAATCCCTCCC,  downstream forward: _UP4_CTTATTCAAGGAGGAGTGAG
References
12850135,15968044,11466295,16091051,22215984

1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D

Page visits: 2875

Time of last update: 2022-09-27 20:45:43

Author of last update: Melvin.boenninger