SubtiWiki SubtiWiki
yycS

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yycS
168

unknown

locus
BSU_40240
Molecular weight
15.68 kDa
pI
4.51
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yycS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,135,351  4,135,764
Expression and Regulation
Operons
genes
[gene|1F947DFED973F22A139B0F501723B237BB8F2E33|yycS]
description
[pubmed|22383849]
Open in new tab

[gene|1F947DFED973F22A139B0F501723B237BB8F2E33|yycS]

2020-11-06 12:56:32

Jstuelk

0

34039fc3330cfb64501a206762bfd51f165eee30

2E84A047AFCC17592C62DE2853F7B36F62750B8A

Biological materials
Mutant
MGNA-B815 (yycS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1814 NBRP B. subtilis, Japan]
BKE40240 ([gene|1F947DFED973F22A139B0F501723B237BB8F2E33|yycS]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATGCAGACCTCCCCACA,  downstream forward: _UP4_TAAAGCCGGCGTTCTGAGAA
BKK40240 ([gene|1F947DFED973F22A139B0F501723B237BB8F2E33|yycS]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATGCAGACCTCCCCACA,  downstream forward: _UP4_TAAAGCCGGCGTTCTGAGAA

1F947DFED973F22A139B0F501723B237BB8F2E33

Page visits: 945

Time of last update: 2021-12-27 09:15:57

Author of last update: Bzhu