SubtiWiki SubtiWiki
acpS
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

acpS
168

acyl-carrier protein synthase, 4-phosphopantetheine transferase

locus
BSU_04620
Molecular weight
13.58 kDa
pI
9.91
Protein length
Gene length
function
fatty acid biosynthesis
product
acyl-carrier protein synthase
essential
yes
ec
2.7.8.7
synonyms
acpS, ydcB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0736

This gene is a member of the following regulons

Gene
Coordinates
515,710  516,075
Phenotypes of a mutant
essential [Pubmed|12682299]
The protein
Catalyzed reaction/ biological activity
CoA-(4'-phosphopantetheine) + apo-[acyl-carrier-protein] --> adenosine 3',5'-bisphosphate + holo-[acyl-carrier-protein] (according to UniProt)
Protein family
P-Pant transferase superfamily (with [protein|1627167E7E9DBE444161A94D9F76317612C6401C|sfp/2], according to UniProt)
[wiki|Cofactors]
magnesium [Pubmed|11489886]
Structure
[PDB|1F7T] [Pubmed|10997907], [PDB|1F80] (complex with [protein|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|acpA]) [Pubmed|10997907]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Biological materials
Mutant
MGNA-C103 (ydcB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2101 NBRP B. subtilis, Japan]
BKE04620 ([gene|200BE4802FCE3C860565B374EAADC9C1FEEF3E49|acpS]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATGATAACCTCCTTT,  downstream forward: _UP4_TAGTCTGCATATTAGGGAAA
References
Reviews
15952903
Original Publications
11489886,15955059,10997907,11867633,30283133

200BE4802FCE3C860565B374EAADC9C1FEEF3E49

Page visits: 2073

Time of last update: 2021-09-21 18:32:25

Author of last update: Melvin.boenninger