SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


1-pyrroline-5-carboxylate dehydrogenase

Molecular weight
56.32 kDa
Protein length
Gene length
proline utilization
1-pyrroline-5-carboxylate dehydrogenase
putC, ycgN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

345,479  347,026
Phenotypes of a mutant
no growth with proline as single source of carbon or nitrogen [Pubmed|21840319]
The protein
Catalyzed reaction/ biological activity
H2O + L-glutamate 5-semialdehyde + NAD+ --> 2 H+ + L-glutamate + NADH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
[PDB|3RJL] (1-pyrroline-5-carboxylate dehydrogenase from ''Bacillus licheniformis'', 90% identity, 97% similarity)
Paralogous protein(s)
[protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]
Expression and Regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]: activation, [Pubmed|21840319,21964733,22139509], in [regulon|protein:C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR regulon]
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, displacement of [protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR] [Pubmed|21840319], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21840319,21964733,22139509], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
overexpressed in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [PubMed|14976255]
the [gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP] part of the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Open in new tab


2021-12-24 08:01:50





Biological materials
GP3904 (''[gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]''::''aphA3''), available in [wiki|Jörg Stülke]'s lab
MGNA-B993 (ycgN::erm), available at the [ NBRP B. subtilis, Japan]
BKE03210 ([gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGATAATCTCTC,  downstream forward: _UP4_TAAGCGGGACTAAATGGGCA
BKK03210 ([gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGATAATCTCTC,  downstream forward: _UP4_TAAGCGGGACTAAATGGGCA


Page visits: 1915

Time of last update: 2022-01-24 21:52:05

Author of last update: Robert.warneke