lipB

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

lipB
168

extracellular esterase, lipase

locus
BSU_08350
Molecular weight
22.22 kDa
pI
9.68
Protein length
Gene length
function
lipid degradation
product
extracellular esterase, lipase
essential
no
synonyms
lipB, yfiP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1075

This gene is a member of the following regulons

Gene
Coordinates
910,019  910,651
The protein
Catalyzed reaction/ biological activity
triacylglycerol + H2O --> diacylglycerol + fatty acid + H+ (according to UniProt)
Protein family
[wiki|AB hydrolase superfamily] (according to UniProt)
Structure
[PDB|2QXT] ([protein|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip], 75% identity) [pubmed|18053819]
[AF|Q79F14]
Paralogous protein(s)
[protein|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip]
Expression and Regulation
Operons
genes
[gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]
description
[pubmed|22383849]
Open in new tab

[gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]

2022-05-10 12:31:26

Jstuelk

13

5f188a3e5997c107273666037f08194fbbaa6bd8

CCD7C94DF490C5BF771C20BB9CA2BF625157FE68

Biological materials
Mutant
MGNA-C304 (lipB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2302 NBRP B. subtilis, Japan]
BKE08350 ([gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTTATTCCCCCAAAAA,  downstream forward: _UP4_TAATATCTTCAAAAAACAAC
BKK08350 ([gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTTATTCCCCCAAAAA,  downstream forward: _UP4_TAATATCTTCAAAAAACAAC
References
12951259,11029590,11583117,10913700,18053819

2053E27BE6837D2B167960C9B07C8B7B7BBABE25

Page visits: 1797

Time of last update: 2022-05-24 20:03:55

Author of last update: Melvin.boenninger