lipB
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

lipB
168

extracellular esterase, lipase

locus
BSU_08350
Molecular weight
22.22 kDa
pI
9.68
Protein length
Gene length
function
lipid degradation
product
extracellular esterase, lipase
essential
no
synonyms
lipB, yfiP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1075

This gene is a member of the following regulons

Gene
Coordinates
910,019  910,651
The protein
Catalyzed reaction/ biological activity
triacylglycerol + H2O --> diacylglycerol + fatty acid + H+ (according to UniProt)
Protein family
[wiki|AB hydrolase superfamily] (according to UniProt)
Structure
[PDB|2QXT] ([protein|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip], 75% identity) [pubmed|18053819]
[AF|Q79F14]
Paralogous protein(s)
[protein|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|lip]
Expression and Regulation
Operons
genes
[gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]
description
[pubmed|22383849]
Open in new tab

[gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]

2022-07-02 20:29:39

Jstuelk

15

5f188a3e5997c107273666037f08194fbbaa6bd8

CCD7C94DF490C5BF771C20BB9CA2BF625157FE68

Biological materials
Mutant
MGNA-C304 (lipB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2302 NBRP B. subtilis, Japan]
BKE08350 ([gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTTATTCCCCCAAAAA,  downstream forward: _UP4_TAATATCTTCAAAAAACAAC
BKK08350 ([gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTTTATTCCCCCAAAAA,  downstream forward: _UP4_TAATATCTTCAAAAAACAAC
References
12951259,11029590,11583117,10913700,18053819

2053E27BE6837D2B167960C9B07C8B7B7BBABE25

Page visits: 1928

Time of last update: 2022-08-16 20:17:57

Author of last update: Melvin.boenninger