tcyA

tcyA
168

cystine and diaminopimelate [wiki|ABC transporter] (binding protein)

locus
BSU_03610
Molecular weight
29.32 kDa
pI
9.12
Protein length
Gene length
function
cystine uptake
product
cystine and diaminopimelate [wiki|ABC transporter] (binding protein)
essential
no
synonyms
tcyA, yckK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0834

This gene is a member of the following regulons

Gene
Coordinates
410,656  411,462
The protein
Catalyzed reaction/ biological activity
uptake of cystine and diaminopimelate [pubmed|29995990]
Protein family
[wiki|bacterial solute-binding protein 3 family] (according to UniProt)
Structure
[PDB|2YLN] (from Neisseria gonorrhoeae, 54% identity) [pubmed|22138345]
[AF|P42199]
Paralogous protein(s)
[protein|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]
[wiki|Localization]
attached to the membrane via [protein|9400DF25487461E3738DDDC72BDDB1589281409D|tcyB] [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|tcyA]-[gene|9400DF25487461E3738DDDC72BDDB1589281409D|tcyB]-[gene|B453986691E1231A1C565D469A2A60EBFF2F6BD3|tcyC]
description
[Pubmed|22383849,15262924]
regulation
strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
Open in new tab

[gene|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|tcyA]→[gene|B453986691E1231A1C565D469A2A60EBFF2F6BD3|tcyC]

2022-11-28 18:17:42

Jstuelk

31

4d611b63f86c92d9ecb8c2daaa53e692acd195f5

768128284DD011A0C571EBC11696DA21513C3B17

Biological materials
Mutant
BKE03610 ([gene|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|tcyA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTCCCCACTTTTC,  downstream forward: _UP4_GAAGATGTTTCTAAATAATC
BKK03610 ([gene|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|tcyA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTCCCCACTTTTC,  downstream forward: _UP4_GAAGATGTTTCTAAATAATC
References
15262924,10092453,7551042,23033921,22138345,29995990

2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3

Page visits: 2254

Time of last update: 2022-11-28 22:31:31

Author of last update: Melvin.boenninger