bacC

bacC
168

dihydroanticapsin 7-dehydrogenase

locus
BSU_37720
Molecular weight
27.17 kDa
pI
4.96
Protein length
Gene length
function
biosynthesis of the antibiotic bacilysin
product
dihydroanticapsin 7-dehydrogenase
essential
no
synonyms
bacC, ywfD, ipa-82d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
3,872,105  3,872,872
The protein
Catalyzed reaction/ biological activity
oxidation of the C(7)-hydroxyl, penultimate step in bacilysin biosynthesis [Pubmed|23317005]
L-dihydroanticapsin + NAD+ --> H+ + L-anticapsin + NADH (according to UniProt)
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
[wiki|Cofactors]
NAD+ [pubmed|28158843]
Structure
[PDB|5ITV] [pubmed|28158843]
[AF|P39640]
Paralogous protein(s)
[protein|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD], [protein|4DEFC2998464BF8327578C36A13A10DD277F991E|ykvO], [protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|yhxC], [protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|yhxD], [protein|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF], [protein|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF]
[protein|0DD474462720CAEE2AE17017BD7CA385238EBC6F|yxbG], (41,1%)
[protein|0FD332269D2D6103E57ACE719E39977C68E38F0A|yvrD], (32,1%)
Expression and Regulation
Operons
genes
[gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
description
[Pubmed|12372825]
regulation
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12372825,21709425], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12697329,21709425], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|19801406], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|19801406], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]→[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]

2023-02-05 16:33:40

Jstuelk

54

7D644717829C1A41F65E52A4312081846FB55951

33F4BF1A14F6AC22A6ACC7091140A7F012E3837C

Biological materials
Mutant
MGNA-B669 (ywfD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1668 NBRP B. subtilis, Japan]
BKE37720 ([gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGTTTTATCGGTGAGGTTCA,  downstream forward: _UP4_CAATAGAGAAGGAGTGTTTT
BKK37720 ([gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGTTTTATCGGTGAGGTTCA,  downstream forward: _UP4_CAATAGAGAAGGAGTGTTTT
References
15609023,12372825,21948839,19801406,28158843

20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993

Page visits: 3491

Time of last update: 2023-02-07 15:23:41

Author of last update: Melvin.boenninger