ycxC

ycxC
168

unknown

locus
BSU_03550
Molecular weight
33.89 kDa
pI
10.02
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ycxC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

Gene
Coordinates
405,069  406,007
The protein
Protein family
[wiki|eamA transporter family] (according to UniProt)
[wiki|Domains]
2[wiki|EamA domain]s (aa 18-142, aa 164-297) (according to UniProt)
Structure
[AF|Q08794]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|20AE0AE853AD334D4CC8E3D6466BD282E1A2074E|ycxC]-[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]
description
[pubmed|22383849]
Open in new tab

[gene|20AE0AE853AD334D4CC8E3D6466BD282E1A2074E|ycxC]→[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]

2022-11-22 18:22:04

Jstuelk

18

858fa54cea02815cbf2bdbe51b0060b26c15b84e

1913E4BCD72D997105649FCADDA8538BA35533D5

Biological materials
Mutant
MGNA-C003 (ycxC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2001 NBRP B. subtilis, Japan]
BKE03550 ([gene|20AE0AE853AD334D4CC8E3D6466BD282E1A2074E|ycxC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGGGAAGGGCTCCTT,  downstream forward: _UP4_TGAGAAATTATGCTAGACTA
BKK03550 ([gene|20AE0AE853AD334D4CC8E3D6466BD282E1A2074E|ycxC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGGGAAGGGCTCCTT,  downstream forward: _UP4_TGAGAAATTATGCTAGACTA

20AE0AE853AD334D4CC8E3D6466BD282E1A2074E

Page visits: 1276

Time of last update: 2022-11-29 05:30:16

Author of last update: Melvin.boenninger