bcaP

bcaP
168

amino acid transporter, major transporter for isoleucine, valine and threonine, minor serine transporter

locus
BSU_09460
Molecular weight
49.55 kDa
pI
9.73
Protein length
Gene length
function
uptake of branched-chain amino acids, threonine, and serine
product
amino acid transporter
essential
no
synonyms
bcaP, yhdG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0531

This gene is a member of the following regulons

Gene
Coordinates
1,023,350  1,024,747
Phenotypes of a mutant
no phenotype for the single mutant, the triple ''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ] [gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations [Pubmed|25645558]
resistant to growth inhibition by high concentrations of threonine [Pubmed|32743959,25645558]
resistant to 4-hydroxythreonine [pubmed|25777134]
The protein
Catalyzed reaction/ biological activity
high affinity uptake of isoleucine and valine [Pubmed|25645558]
uptake of threonine [pubmed|32743959]
uptake of serine [pubmed|32743959]
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
Structure
[PDB|5OQT] (from Geobacillus kaustophilus, 60% identity) [pubmed|29416041]
[AF|O07576]
Paralogous protein(s)
[protein|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]
description
[pubmed|22383849]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]

2022-11-23 06:47:44

Jstuelk

18

69dd9918ab43b5515065d91467e545873ac776e9

D8EAEDA62F9D207F520822508309B9E19EA4BA81

Biological materials
Mutant
GP4157 (Δ[gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]::''aphA3'', Δ[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::''ermC''), available in [wiki|Jörg Stülke]'s lab
MGNA-B479 ([gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::''erm''), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1478 NBRP B. subtilis, Japan]
BKE09460 ([gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09460 BGSC] and in [wiki|Fabian Commichau]'s and [wiki|Jörg Stülke]'s labs),  [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA,  downstream forward: _UP4_TAACCTTTTGATAAAGAGAG
BKK09460 ([gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA,  downstream forward: _UP4_TAACCTTTTGATAAAGAGAG
References
18083814,12618455,20935095,18763711,21097623,21699902,25645558,25777134,29416041,32743959

210C83EBEBD3DE4946BC511E0249D0032A7CE3D0

Page visits: 3247

Time of last update: 2022-11-27 04:07:32

Author of last update: Jstuelk