kinB

kinB
168

two-component sensor kinase, phosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F], part of the [wiki|phosphorelay]

locus
BSU_31450
Molecular weight
47.71 kDa
pI
6.68
Protein length
Gene length
function
initiation of [wiki|sporulation]
product
two-component sensor kinase
essential
no
synonyms
kinB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5806

This gene is a member of the following regulons

Gene
Coordinates
3,230,067 → 3,231,353
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]
mainly active in the older, inner regions of a colony (with [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA]) [Pubmed|21097618]
senses potassium level in the medium during initiation of [wiki|sliding] [Pubmed|26152584]
senses changes in respiratory activity [pubmed|23599347]
senses nutrient starvation in MM medium to initiate sporulation [pubmed|29314743]
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
six transmembrane segments, C-terminal histidine phosphotransferase domain
selectivity filter sequence of potassium channels that is required for [wiki|sliding] but not for [wiki|sporulation] [Pubmed|26152584]
[wiki|Histidine kinase domain] (aa 218-426) (according to UniProt)
Structure
[PDB|3D36] (from G. stearothermophilus, complex with [protein|CEFD10FAFA0DBC83CD2B61DAC9339FEE025B1611|sda]) [pubmed|19101565]
[AF|Q08430]
Modification
autophosphorylation on a His residue
Effectors of protein activity
activity is triggered at low respiratory activity, this depends on a functional interaction with the respiration apparatus [Pubmed|23599347]
[wiki|Localization]
cell membrane (integral membrane protein) [Pubmed|23599347]
Expression and Regulation
Operons
genes
[gene|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB]-[gene|18867F99B039D20DBCF004BC72E35CF0AE8FE467|kapB]
description
[Pubmed|8497199]
regulation
induced upon addition of decoyinine (positive [wiki|stringent response]) [Pubmed|23378509]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
stringent response: positive regulation, [Pubmed|23378509], in [regulon|other_regulator:stringent response|stringent response]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [pubmed|29321771], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8497199], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB]→[gene|18867F99B039D20DBCF004BC72E35CF0AE8FE467|kapB]

2022-11-27 15:38:43

Jstuelk

22

4ea8e180d6fecf25f0027de7b12648e29cfa1fbd

336851E03072F77B6A15C06368A0B47EF426DC11

additional information
[gene|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB] expression is increased in a [gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho] mutant due to increased transcriptional readthrough [pubmed|28723971]
Biological materials
Mutant
JH19980 (''kinB''::''tet'') [Pubmed|9334321]
BKE31450 (Δ[gene|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCGTGTGAAATCCTTTC,  downstream forward: _UP4_TAGCAAATCGATTGGAACTT
BKK31450 (Δ[gene|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCGTGTGAAATCCTTTC,  downstream forward: _UP4_TAGCAAATCGATTGGAACTT
References
26152584,8576055,16166384,9299348,8497199,10094672,9426145,11069677,12618455,11902725,12618455,7592498,21097618,19101565,23378509,23599347,26152584,28723971,29314743,29321771,19101565

2111AC1AE49D1006E10DC127BF5B7A0327DE94A7

Page visits: 4903

Time of last update: 2022-12-07 16:04:05

Author of last update: Jstuelk