rsiX

rsiX
168

anti-[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]

locus
BSU_23090
Molecular weight
41.15 kDa
pI
5.45
Protein length
Gene length
function
control of [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX] activity
product
anti-[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]
essential
no
ec
null
synonyms
rsiX, ypuN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,413,585  2,414,691
Phenotypes of a mutant
inactivation of ''[gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX]'' strongly restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
increased expression of the [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO] operon [pubmed|32483306]
The protein
Structure
[AF|P35166]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]-[gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX]
description
[Pubmed|7934830]
regulation
induced by glucose [Pubmed|27965645], this depends on [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]: activation, [Pubmed|16306698], in [regulon|protein:7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9636707], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|9636707], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]→[gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX]

2022-06-15 17:10:05

Jstuelk

18

dfd4194b5990a1043dfc2b94c54efc3adc6fd3a9

F164A2C76E6C51307B22A33B48976CF41577CBAC

Biological materials
Mutant
MGNA-A180 (ypuN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/180 NBRP B. subtilis, Japan]
BKE23090 ([gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATATCCTGAGGCGAACGAT,  downstream forward: _UP4_TAAAAAGAGCCCTTTAAGGC
BKK23090 ([gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATATCCTGAGGCGAACGAT,  downstream forward: _UP4_TAAAAAGAGCCCTTTAAGGC
References
14993308,7934830,16306698,9636707,9393439,22211522,32483306

21D260E900776EAAF4B6000A3365DCA9241EACA6

Page visits: 2284

Time of last update: 2022-06-24 20:11:38

Author of last update: Jstuelk