spoIIGA

spoIIGA
168

Pro-[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE] protease

locus
BSU_15310
Molecular weight
34.70 kDa
pI
8.55
Protein length
Gene length
function
maturation of [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]
product
Pro-[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE] protease
essential
no
synonyms
spoIIGA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5818

This gene is a member of the following regulons

Gene
Coordinates
1,603,779  1,604,708
The protein
Protein family
peptidase U4 family (single member, according to UniProt)
Structure
[AF|P13801]
Effectors of protein activity
[protein|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA] protease activity is stimulated by the interaction with [protein|9F338225E1286D530EAAAB504DEC8D5AFA06AC8D|spoIIR] in the intermembrane space between the forespore and the mother cell [Pubmed|22111992]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA]-[gene|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]-[gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]
description
[Pubmed|1902213]
regulation
''[wiki|spoIIGA]'': expressed under conditions that trigger sporulation ([wiki|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8288522,15687200 PubMed]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|8288522,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2512576], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|1902213], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
additional information
the mRNA half-life is about 2.6 min [PubMed|24163345]
Open in new tab

[gene|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA]→[gene|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]

2022-12-30 23:19:20

ghost

44

3354b759a5d3c11fb5b0d40216c1a7e1d8249a30

020EF37B0706DBB0AF1DC411F77E0B6D94001319

Biological materials
Mutant
BKE15310 ([gene|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATCTGACTCCTTTCTTT,  downstream forward: _UP4_TAATGTTCGCAAATGTCCGT
BKK15310 ([gene|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACATCTGACTCCTTTCTTT,  downstream forward: _UP4_TAATGTTCGCAAATGTCCGT
References
Reviews
31350897,35638784
Original Publications
19581368,1537790,2448286,8288522,8231806,8002606,8730857,1744037,9287022,7585939,18296515,8288522,15687200

221829E084DA78ACE1C2DFCEB6E59EDA534FF55D

Page visits: 2817

Time of last update: 2023-02-06 12:44:34

Author of last update: Jstuelk