mmgA

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

mmgA
168

degradative acetoacetyl-CoA thiolase

locus
BSU_24170
Molecular weight
41.02 kDa
pI
5.9
Protein length
Gene length
function
mother cell metabolism, leucine utilization
product
degradative acetoacetyl-CoA thiolase
essential
no
ec
2.3.1.9
synonyms
mmgA, yqiL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0183

This gene is a member of the following regulons

Gene
Coordinates
2,512,861  2,514,042
The protein
Catalyzed reaction/ biological activity
2 acetyl-CoA --> CoA + acetoacetyl-CoA  [Pubmed|19935659]
Protein family
[wiki|thiolase-like superfamily] (according to UniProt)
Structure
[PDB|3SS6] (the protein of ''B. anthracis'', 44% identity, 73% similarity)
[AF|P45855]
Paralogous protein(s)
[protein|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS], [protein|07498A0A3CB598A6E388540124A4F56E781C86FA|fadA]
Expression and Regulation
Operons
genes
[gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]-[gene|FB95ABDC8557F26525E8B211595C130A7203ABC0|mmgB]-[gene|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]-[gene|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]-[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]-[gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]
description
[Pubmed|8759838]
regulation
expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|15699190,8759838]
strongly expressed during oligotrophic growth [pubmed|30792386]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8759838], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,8759838], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]→[gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]

2022-04-28 18:42:27

Jstuelk

21

be5c5568e93dc96bd335d396c9ced168a6874b5d

43FB5BE81B1A707E4F1C97099736CD2DD49A154C

Biological materials
Mutant
BKE24170 ([gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTTTCACCTCATTCAG,  downstream forward: _UP4_TAAAACATGATGAAAAAGGG
BKK24170 ([gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTTTCACCTCATTCAG,  downstream forward: _UP4_TAAAACATGATGAAAAAGGG
References
18246303,8759838,15699190,19935659,23840410

226100C0AC13BB345DB0F0F309DEB7F91F3770B0

Page visits: 2079

Time of last update: 2022-05-24 20:23:35

Author of last update: Melvin.boenninger