mmgA
168
degradative acetoacetyl-CoA thiolase
locus
BSU_24170
Molecular weight
41.02 kDa
pI
5.9
function
mother cell metabolism, leucine utilization
product
degradative acetoacetyl-CoA thiolase
essential
no
ec
2.3.1.9
synonyms
mmgA, yqiL
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0183 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
2,512,861 2,514,042
The protein
Catalyzed reaction/ biological activity
2 acetyl-CoA --> CoA + acetoacetyl-CoA [Pubmed|19935659]
Protein family
[wiki|thiolase-like superfamily] (according to UniProt)
Structure
[PDB|3SS6] (the protein of ''B. anthracis'', 44% identity, 73% similarity)
[AF|P45855]
Paralogous protein(s)
[protein|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS], [protein|07498A0A3CB598A6E388540124A4F56E781C86FA|fadA]
Expression and Regulation
Operons
genes
[gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]-[gene|FB95ABDC8557F26525E8B211595C130A7203ABC0|mmgB]-[gene|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]-[gene|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]-[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]-[gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]
description
[Pubmed|8759838]
regulation
expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|15699190,8759838]
strongly expressed during oligotrophic growth [pubmed|30792386]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8759838], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,8759838], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Biological materials
Mutant
BKE24170 ([gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTTCACCTCATTCAG, downstream forward: _UP4_TAAAACATGATGAAAAAGGG
BKK24170 ([gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTTCACCTCATTCAG, downstream forward: _UP4_TAAAACATGATGAAAAAGGG
References
Page visits: 5995
Time of last update: 2025-10-24 05:03:08
Author of last update: Melvin.boenninger