ybfJ

ybfJ
168

unknown

locus
BSU_02250
Molecular weight
14.31 kDa
pI
5.64
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybfJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
246,094  246,492
The protein
Structure
[AF|O31451]
Expression and Regulation
Operons
genes
[gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]-[gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]
description
[Pubmed|12107147]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|25666135], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]→[gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]

2022-11-28 16:30:06

ghost

29

c94f708bb33d19ebb7718a8e2cca7da24f7d075f

F0A001416ED39498CAC09F0DF093E069C2540398

Biological materials
Mutant
BKE02250 ([gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATATGGCTAGTTTGC,  downstream forward: _UP4_TAGCAGTTTCCTTGATTTTA
BKK02250 ([gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATATGGCTAGTTTGC,  downstream forward: _UP4_TAGCAGTTTCCTTGATTTTA
References
12107147

22A5905A0C2A9303C166A5C2D784AF0B6541A311

Page visits: 1481

Time of last update: 2022-11-27 14:27:35

Author of last update: Bzhu