yszA

yszA
168

unknown

locus
BSU_28099
Molecular weight
7.00 kDa
pI
10
Protein length
Gene length
function
unknown
product
unknown
essential
-
synonyms
yszA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

The protein
Structure
[AF|C0H465]
Biological materials
Mutant
BKE28099 ([gene|23217CBC6DE637FD18FF32167E7AC188BF4A32F2|yszA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28099 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGGTGCATCCTCCTCTAC,  downstream forward: _UP4_ATATAAACAAACAAGTCCGC
BKK28099 ([gene|23217CBC6DE637FD18FF32167E7AC188BF4A32F2|yszA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28099 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGGTGCATCCTCCTCTAC,  downstream forward: _UP4_ATATAAACAAACAAGTCCGC
References
27766092

23217CBC6DE637FD18FF32167E7AC188BF4A32F2

Page visits: 1014

Time of last update: 2022-12-04 01:07:06

Author of last update: Bzhu