SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


lincomycin-resistance protein (multidrug resistance pump)

Molecular weight
51.54 kDa
Protein length
Gene length
resistance to lincomycin
lincomycin-resistance protein
lmrB, yccA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

288,653  290,092
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|EmrB family] (according to UniProt)
Paralogous protein(s)
[protein|93159DC7D5C42CFA54F66F232D73F38957243AB7|yhcA], [protein|188742B9A0C95344D32A4C23B9C971660572CF7D|ycnB]
cell membrane (according to UniProt)
Expression and Regulation
induced by flavonoids such as quercetin ([protein|search|LmrA])[Pubmed|17483215]
regulatory mechanism
[protein|52D560AA02F0849CB24460A496021560063B2E12|lmrA]: repression, [Pubmed|15317768], in [regulon|protein:52D560AA02F0849CB24460A496021560063B2E12|lmrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12499232], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab


2022-01-25 06:55:37





Biological materials
GP1701 (''[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]''::''aphA3''), available in [wiki|Jörg Stülke]'s lab
GP1703 (''[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]''::''aphA3'' ''[gene|188742B9A0C95344D32A4C23B9C971660572CF7D|ycnB]''::''spc''), available in [wiki|Jörg Stülke]'s lab
BKE02670 ([gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCCTCTCTATCAAC,  downstream forward: _UP4_TAATATGAAAAGCCCCTGAC
BKK02670 ([gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCCTCTCTATCAAC,  downstream forward: _UP4_TAATATGAAAAGCCCCTGAC


Page visits: 2251

Time of last update: 2022-01-27 13:50:16

Author of last update: Melvin.boenninger