

two-component response regulator

Molecular weight
24.10 kDa
Protein length
Gene length
two-component response regulator

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2197

This gene is a member of the following regulons

3,994,369  3,995,025
The protein
[wiki|Response regulatory domain] (aa 7-123) (according to UniProt)
[wiki|HTH luxR-type domain] (aa 150-215) (according to UniProt)
[PDB|5HEV] ([protein|search|LiaR ]from Enterococcus faecium, 41% identity) [pubmed|27670715]
phosphorylation by [protein|6D10C9232F0D28973F7C3C6ECDFD6948928CB23F|yxjM]
Paralogous protein(s)
[protein|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK], [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR], [protein|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ], [protein|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]
Biological materials
MGNA-B805 (yxjL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1804 NBRP B. subtilis, Japan]
BKE38910 ([gene|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|yxjL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCATCGGCAAGCGCTACGC,  downstream forward: _UP4_TAGAAATCTCTCATCCCGCC
BKK38910 ([gene|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|yxjL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCATCGGCAAGCGCTACGC,  downstream forward: _UP4_TAGAAATCTCTCATCCCGCC


Page visits: 1128

Time of last update: 2023-01-23 08:34:07

Author of last update: Melvin.boenninger