SubtiWiki SubtiWiki
yczM

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yczM
168

putative toxin

locus
BSU_03788
Molecular weight
3.00 kDa
pI
5.275
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yczM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
430,185  430,274
The protein
Protein family
[wiki|SscA family] (according to UniProt)
Expression and Regulation
Operons
genes
[gene|056F20E9D11BFB7A7EB15281902E8A8870BC6CFF|yczN]-[gene|2420C171CBDDC4EC695759EBD2D20CB151C3F73D|yczM]
description
[Pubmed|22383849]
Open in new tab

[gene|056F20E9D11BFB7A7EB15281902E8A8870BC6CFF|yczN]→[gene|2420C171CBDDC4EC695759EBD2D20CB151C3F73D|yczM]

2021-12-29 09:43:02

Jstuelk

2

28606043131cd7e6049ab3444536aa1381d4def8

840FE281FFE3CD7B5A9EB4C86C9E37ACF6454D62

Biological materials
Mutant
BKE03788 ([gene|2420C171CBDDC4EC695759EBD2D20CB151C3F73D|yczM]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03788 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCACCTCCTTGC,  downstream forward: _UP4_TAAATAAACGTAATCTCCAT
BKK03788 ([gene|2420C171CBDDC4EC695759EBD2D20CB151C3F73D|yczM]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03788 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTGCACCTCCTTGC,  downstream forward: _UP4_TAAATAAACGTAATCTCCAT
References
20156992

2420C171CBDDC4EC695759EBD2D20CB151C3F73D

Page visits: 937

Time of last update: 2022-01-18 16:37:21

Author of last update: Melvin.boenninger