SubtiWiki SubtiWiki
rapC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

rapC
168

response regulator aspartate phosphatase, controls [protein|search|ComA ]activity

locus
BSU_03770
Molecular weight
45.47 kDa
pI
5.02
Protein length
Gene length
function
control of [protein|search|ComA ]activity
product
response regulator aspartate phosphatase
essential
no
synonyms
rapC, yclL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
428,831  429,979
The protein
Catalyzed reaction/ biological activity
control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] activity [Pubmed|12950917]
Protein family
[wiki|RAP family] (according to UniProt)
[wiki|Domains]
five [wiki|TPR repeat|tetratricopeptide repeats] (according to UniProt)
Structure
[PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF], 57% identity) [pubmed|23526880]
Effectors of protein activity
binding of [protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC] to [protein|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC] prevents it from binding [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] [Pubmed|12950917]
Expression and Regulation
Operons
genes
[gene|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC]-[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]
description
[Pubmed|10464187]
regulation
expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|10464187], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]) [Pubmed|16091051], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10464187], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|10464187], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC]→[gene|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|phrC]

2021-11-16 12:34:46

ghost

6

d557cd87272a9075c3ffbe931e4b5edeb40e54a7

4C234676BFA582602106F93B45E171FF3EF2C098

Biological materials
Mutant
MGNA-C065 (rapC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2063 NBRP B. subtilis, Japan]
BKE03770 ([gene|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCACCCTCTCCCA,  downstream forward: _UP4_CAAATACAAAGGAGTGAAGG
BKK03770 ([gene|242632B27E0E3AB15777E9FBA3FC746D00CE97F9|rapC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCACCCTCTCCCA,  downstream forward: _UP4_CAAATACAAAGGAGTGAAGG
References
12950917,16091051,10464187,26582911,23526880

242632B27E0E3AB15777E9FBA3FC746D00CE97F9

Page visits: 2310

Time of last update: 2022-01-18 16:27:45

Author of last update: Melvin.boenninger