ydaB

ydaB
168

similar to acyl-CoA synthetase (long-chain-fatty-acid--CoA ligase)

locus
BSU_04170
Molecular weight
51.07 kDa
pI
4.85
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydaB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0318

This gene is a member of the following regulons

Gene
Coordinates
469,426  470,937
The protein
Protein family
[wiki|ATP-dependent AMP-binding enzyme family] (according to UniProt)
Structure
[PDB|3R44] (from Mycobacterium tuberculosis, 33% identity) [pubmed|22560731]
[AF|P96575]
Expression and Regulation
Operons
genes
[gene|2436420C7781DCB61B9A939B47747265E23740A5|ydaB]
description
[Pubmed|21815947]
additional information
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 2 to 80 min) [PubMed|21815947]
Open in new tab

[gene|2436420C7781DCB61B9A939B47747265E23740A5|ydaB]

2022-11-18 09:32:41

Jstuelk

12

d27225a5ec7e819f7308bdb0c7abd73478460472

08032C503BBFA3D6E2927D6D52A4804560D45871

Biological materials
Mutant
BKE04170 ([gene|2436420C7781DCB61B9A939B47747265E23740A5|ydaB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCGTCATCTCCTATAT,  downstream forward: _UP4_TCATAAAAGAAGAAGCCCGT
BKK04170 ([gene|2436420C7781DCB61B9A939B47747265E23740A5|ydaB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCGTCATCTCCTATAT,  downstream forward: _UP4_TCATAAAAGAAGAAGCCCGT
References
1460045,21815947,22560731

2436420C7781DCB61B9A939B47747265E23740A5

Page visits: 1152

Time of last update: 2022-11-27 07:47:48

Author of last update: Jstuelk