ydeC

ydeC
168

similar to transcription factor (AraC family)

locus
BSU_05150
Molecular weight
34.07 kDa
pI
6.87
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ydeC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2207

This gene is a member of the following regulons

Gene
Coordinates
561,514  562,389
The protein
Protein family
[wiki|AraC family]
[wiki|Domains]
[wiki|HTH araC/xylS-type domain] (aa 191-289) (according to UniProt)
Structure
[AF|P96660]
Expression and Regulation
Operons
genes
[gene|24A86A4846187E6026A2B7645DC4B7C70908942E|ydeC]-[gene|CBEB1C62D727CF320E82C3ED636894B50F11E0AE|ydzE]
description
[pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11532142], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|24A86A4846187E6026A2B7645DC4B7C70908942E|ydeC]->[gene|CBEB1C62D727CF320E82C3ED636894B50F11E0AE|ydzE]

2022-11-30 10:59:15

Bzhu

18

59bc0174fd3aef20a892bb083ff6607114d252b5

61AFF2F491CBF04495E610BD7F03138B1FEF0965

Biological materials
Mutant
MGNA-C079 (ydeC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2077 NBRP B. subtilis, Japan]
BKE05150 ([gene|24A86A4846187E6026A2B7645DC4B7C70908942E|ydeC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTGACTTCACACCTCA,  downstream forward: _UP4_TAAAGTTTATTCTATTAATA
BKK05150 ([gene|24A86A4846187E6026A2B7645DC4B7C70908942E|ydeC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTGACTTCACACCTCA,  downstream forward: _UP4_TAAAGTTTATTCTATTAATA
References
23504016

24A86A4846187E6026A2B7645DC4B7C70908942E

Page visits: 1052

Time of last update: 2022-12-01 00:54:12

Author of last update: Melvin.boenninger