aerA
168
transcription activator, amino acid export regulator A (AraC family)
locus
BSU_05150
Molecular weight
34.07 kDa
pI
6.87
function
control of amino acid export
product
amino acid export regulator A
essential
no
ec
null
synonyms
ydeC
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG2207 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
561,514 562,389
The protein
Catalyzed reaction/ biological activity
the protein is inactive under most conditions, if activated (either by mutations or by 2,3-diaminopropionic acid) activation of [gene|3BD05DE3ED5B293980F47EB621C54C7339F78DC7|aexA] expression [pubmed|38470260]
Protein family
[wiki|AraC family]
[wiki|Domains]
[wiki|HTH araC/xylS-type domain] (aa 191-289) (according to UniProt)
Structure
[AF|P96660]
Expression and Regulation
Operons
genes
[gene|24A86A4846187E6026A2B7645DC4B7C70908942E|aerA]-[gene|CBEB1C62D727CF320E82C3ED636894B50F11E0AE|ydzE]
description
[pubmed|22383849]
Biological materials
Mutant
GP4117 (trpC2 [gene|24A86A4846187E6026A2B7645DC4B7C70908942E|aerA] Y179D), available in [wiki|Jörg Stülke]'s lab [pubmed|38470260]
GP4119 (trpC2 [gene|24A86A4846187E6026A2B7645DC4B7C70908942E|aerA] L122W), available in [wiki|Jörg Stülke]'s lab [pubmed|38470260]
GP4498 (trpC2 Δ[gene|24A86A4846187E6026A2B7645DC4B7C70908942E|aerA]::neo), available in [wiki|Jörg Stülke]'s lab
MGNA-C079 (ydeC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2077 NBRP B. subtilis, Japan]
BKE05150 ([gene|24A86A4846187E6026A2B7645DC4B7C70908942E|aerA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGACTTCACACCTCA, downstream forward: _UP4_TAAAGTTTATTCTATTAATA
BKK05150 ([gene|24A86A4846187E6026A2B7645DC4B7C70908942E|aerA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGACTTCACACCTCA, downstream forward: _UP4_TAAAGTTTATTCTATTAATA
lacZ fusion
GP4439, kana, (based on [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab [pubmed|38470260]
GP4441, cat, (based on [wiki|pAC5]), available in [wiki|Jörg Stülke]'s lab
References
Page visits: 3218
Time of last update: 2025-10-29 12:27:50
Author of last update: Robert.warneke