recG

recG
168

ATP-dependent DNA helicase, branch migration translocase, required for DNA repair and chromosomal segregation

locus
BSU_15870
Molecular weight
77.96 kDa
pI
7.09
Protein length
Gene length
function
DNA repair and chromosomal segregation
product
ATP-dependent DNA helicase, branch migration translocase
essential
no
synonyms
recG, ylpB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1200

This gene is a member of the following regulons

Gene
Coordinates
1,659,810  1,661,858
Phenotypes of a mutant
a [gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2] [gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] double mutant is not viable [pubmed|28527403]
a [gene|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|recU] [gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] double mutant is not viable [pubmed|16020779]
a [gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB] [gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] mutant is not viable [pubmed|16020779]
a [gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG] [gene|151F226370D225776F3FE7EA4901485095F1AC45|radA] double mutant is non-transformable with chromosomal DNA [pubmed|31350886]
The protein
Catalyzed reaction/ biological activity
binds and unwinds Holliday junction DNA [Pubmed|24770420]
ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
Protein family
[wiki|helicase family] (according to UniProt)
[wiki|Domains]
[wiki|Helicase ATP-binding domain] (aa 271-432) (according to UniProt)
[wiki|Helicase C-terminal domain] (aa 451-611) (according to UniProt)
Structure
[PDB|1GM5] (from ''Thermotoga maritima'', 43% identity, 62% similarity)
[AF|O34942]
Effectors of protein activity
[protein|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]-mediated fork reversal and fork restoration are limited by [protein|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] [pubmed|34073022]
Paralogous protein(s)
[protein|AD1F39823ABCE2A222259B879513752942C59590|mfd]
[wiki|Localization]
associated with the [wiki|replisome] [pubmed|17853894]
Expression and Regulation
Operons
genes
[gene|BC19D5B3764503298ED7136FC9F63A68F6AC464F|sdaAB]-[gene|8361D87307D2E8350945F592ABD24E2109E2E81A|sdaAA]-[gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]
description
[Pubmed|22383849]
Open in new tab

[gene|BC19D5B3764503298ED7136FC9F63A68F6AC464F|sdaAB]→[gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]

2022-12-29 13:47:13

Jstuelk

39

75880fc7bd1a3984391d66dc804deda756b8db43

B3C473F399334F3F232E4FA23EE6A4A24E3A8838

Biological materials
Mutant
1A897 (no resistance), [Pubmed|16020779], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A897&Search=1A897 BGSC]
BKE15870 ([gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCAATACCCTTAATGTTAG,  downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG
BKK15870 ([gene|24B1C2A663A5B7C45940272595868F9F05A04A7B|recG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15870 BGSC] and in [wiki|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CCCAATACCCTTAATGTTAG,  downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG
References
17853894,15533834,17640277,24770420,21170359,28527403,31350886,17853894,27038615,16020779,34073022

24B1C2A663A5B7C45940272595868F9F05A04A7B

Page visits: 4253

Time of last update: 2023-02-02 08:58:47

Author of last update: Jstuelk