sigK

sigK
168

[wiki|RNA polymerase ][wiki|sporulation]-specific [wiki|sigma factor ](sigma-K) (5' part of the interrupted [gene|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK] gene), with [gene|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|sigKC]

locus
BSU_25760
Molecular weight
17.00 kDa
pI
8
Protein length
Gene length
function
late mother cell-specific gene expression
product
[wiki|RNA polymerase ][wiki|sporulation]-specific [wiki|sigma factor](sigma-K) (5' part of the gene)
essential
no
synonyms
sigK, sigKN, spoIVCB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5814

This gene is a member of the following regulons

Gene
Coordinates
2,652,993  2,653,463
The protein
Protein family
[wiki|Sigma-70 factor family] (according to UniProt)
Structure
[AF|P12254]
Expression and Regulation
Operons
genes
[gene|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]
description
(composed of [wiki|spoIVCB]-[wiki|spoIIIC]) [Pubmed|2536191]
regulation
expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE], [wiki|SpoIIID]) [Pubmed|15699190,2841290,10075739,7966271]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: repression, [Pubmed|10075739], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: activation, [Pubmed|7966271], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|25983726], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,2841290], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|2841290], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
additional information
'spoIVCB' and '[protein|search|spoIIIC]' form a composite gene in the mother cell during sporulation by excising the intervening DNA sequence.
Open in new tab

[gene|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]

2022-12-30 13:21:37

ghost

33

34233ddc933a88b4ee576c62023e740291d10e6c

016451D024CE72891A3BD518F31705CB28115DBB

Biological materials
Mutant
BKE25760 ([gene|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTCACCTCCACAAAAG,  downstream forward: _UP4_AAAGGGGGGTGCATACACCC
BKK25760 ([gene|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTCACCTCCACAAAAG,  downstream forward: _UP4_AAAGGGGGGTGCATACACCC
References
Reviews
20833318,20836086,31350897,33538382,35638784
Original Publications
14526016,17720779,1900494,10438769,2492118,1691789,2536191,2163341,10931284,1577688,9852018,1942049,7814326,8550479,11959848,9501233,10400595,2115401,7592342,1518043,8226681,9078383,2514119,10611287,14523132,19805276,10075739,7966271,17890309,23585539,23995631,25983726,26953342,29180425,30403663,32515031,35007155
The [wiki|SigK regulon]
16385044,15383836,21670523
Labs working on this gene/protein
[wiki|Arthur Aronson], Purdue University, West Lafayette, USA [http://wwwdev.gradschool.purdue.edu/PULSe/faculty.cfm?fid=5&range=0 homepage]
[wiki|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]

24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4

Page visits: 6530

Time of last update: 2023-02-07 16:22:58

Author of last update: Jstuelk