appC

appC
168

oligopeptide [wiki|ABC transporter] (permease)

locus
BSU_11400
Molecular weight
33.27 kDa
pI
9.78
Protein length
Gene length
function
uptake of oligopeptides
product
oligopeptide [wiki|ABC transporter] (permease)
essential
no
synonyms
appC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1173

This gene is a member of the following regulons

Gene
Coordinates
1,216,210  1,217,121
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|OppBC subfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 90-299) (according to UniProt)
Structure
[AF|P42063]
Paralogous protein(s)
[protein|DDBCE73B6AF39E5D669475479186C93F287DA9FC|oppC], [protein|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]
[wiki|Localization]
cell membrane [Pubmed|10092453,18763711]
Expression and Regulation
Operons
genes
[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|DD2C5F549759447FF1C30E5B43BCB74CE4320EF3|appA/1]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]
description
[Pubmed|7997159]
regulation
repressed by [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY] [Pubmed|12618455]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|25755103], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|10383984], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
Open in new tab

[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]→[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]

2022-11-30 15:15:06

Jstuelk

37

b46f08a2cd8f8540d1ae7be3ab793fb86c3b4d9c

D515582AF1C173F5A0D9E2C830FC884903502563

Biological materials
Mutant
GP2100 (D(''[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]'')::''spc''), available in [wiki|Jörg Stülke]'s lab
BKE11400 ([gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTGTTTCCCTCCTTT,  downstream forward: _UP4_TAAAAATGAATATCATATCT
BKK11400 ([gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTGTTTCCCTCCTTT,  downstream forward: _UP4_TAAAAATGAATATCATATCT
References
12618455,7997159,10092453,25755103,10383984,12618455,18763711

252E3F0A05D78CEC46A08B46D1C6133239B6B8BA

Page visits: 2249

Time of last update: 2022-12-01 09:10:33

Author of last update: Melvin.boenninger