SubtiWiki SubtiWiki
ykzE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ykzE
168

unknown

locus
BSU_13510
Molecular weight
6.79 kDa
pI
10.19
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ykzE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,417,719  1,417,895
Expression and Regulation
Operons
genes
[gene|FBC2C990CA15FCE75326F17D0BD64FAC772AC3B9|ykzP]-[gene|25902F1B63034DE3780C279D373F0DE746525C10|ykzE]
description
[Pubmed|22383849]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [pubmed|30782632], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|FBC2C990CA15FCE75326F17D0BD64FAC772AC3B9|ykzP]→[gene|25902F1B63034DE3780C279D373F0DE746525C10|ykzE]

2021-11-08 18:16:19

Jstuelk

2

aeed420dde29fcfd75bdb2f531acabc0b50e91a0

6DE79D8AE03DCFA82AE7C911ABA0D3EBE1F70802

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE13510 ([gene|25902F1B63034DE3780C279D373F0DE746525C10|ykzE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAATTACATGCCTCCCTG,  downstream forward: _UP4_TAAAAAAGACCTCTTAGGCG
BKK13510 ([gene|25902F1B63034DE3780C279D373F0DE746525C10|ykzE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAATTACATGCCTCCCTG,  downstream forward: _UP4_TAAAAAAGACCTCTTAGGCG
References
Research papers
30782632

25902F1B63034DE3780C279D373F0DE746525C10

Page visits: 792

Time of last update: 2021-12-15 23:47:40

Author of last update: Jstuelk