yomL

yomL
168

unknown protein

locus
BSU_21320
Molecular weight
25.28 kDa
pI
9.36
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yomL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

The protein
Structure
[AF|O31973]
Paralogous protein(s)
[protein|D04CF5261C840E9A1BC7FFE5B6F492A46EC0971C|yddT], (the two proteins differ in only 4 out of 228 amino acids)
Biological materials
Mutant
BP118 (yomL::kan), available in [wiki|Fabian Commichau]'s lab [Pubmed|24178028]
BKE21320 ([gene|25ACC4472A56ABF9F0FCA75CC24579FBC59E4C2F|yomL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGAAATCCTCCTTGTG,  downstream forward: _UP4_TAATTTTAAAATCACTTTGT
BKK21320 ([gene|25ACC4472A56ABF9F0FCA75CC24579FBC59E4C2F|yomL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGAAATCCTCCTTGTG,  downstream forward: _UP4_TAATTTTAAAATCACTTTGT
Expression vectors
IPTG inducible expression of Strep-''yomL'' in ''E. coli'': pGP2580 (in [wiki|pGP172]), available in [wiki|Jörg Stülke]'s lab
References
17114254,23420519,24178028

25ACC4472A56ABF9F0FCA75CC24579FBC59E4C2F

Page visits: 1586

Time of last update: 2022-11-26 19:13:00

Author of last update: Jstuelk