rapA
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

rapA
168

response regulator aspartate phosphatase, dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]-P, control of the [wiki|phosphorelay]

locus
BSU_12430
Molecular weight
44.81 kDa
pI
4.85
Protein length
Gene length
function
control of [wiki|sporulation] initiation
product
response regulator aspartate phosphatase
essential
no
synonyms
rapA, gsiAA, spo0L

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,315,869  1,317,005
The protein
Protein family
[wiki|RAP family] (according to UniProt)
[wiki|Domains]
modular organization comprising an amino terminal alpha-helical domain connected to a domain formed by six [wiki|TPR repeat|tetratrichopeptide repeats] [Pubmed|11923303,22267516]
Structure
[PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF], 42% identity) [pubmed|23526880]
[AF|Q00828]
Expression and Regulation
Operons
genes
[gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]-[gene|D31B325366D3F0169E4ECA8871645C7826019C10|phrA]
description
[Pubmed|1378051]
regulation
expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]) [Pubmed|16091051], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|23569278,12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1378051], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]→[gene|D31B325366D3F0169E4ECA8871645C7826019C10|phrA]

2022-07-15 23:23:52

ghost

19

01c2a2d5cbf2bbf9b664fb434ae4609766ddb2ba

B05E6BFE73C0264C2C2D52698EA0051DCC1003E8

Biological materials
Mutant
BKE12430 ([gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAATCCCCCCTTTTGA,  downstream forward: _UP4_CAAATCCAGAGAGGAGATTG
BKK12430 ([gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAATCCCCCCTTTTGA,  downstream forward: _UP4_CAAATCCAGAGAGGAGATTG
References
8643670,8730857,11923303,22267516,14651647,12618455,12107147,19380751,12850135,1378051,16091051,23569278,26582911,27122155,23526880,32132526

25D89EF3C4D57B3E6F9AB0210029651F74356906

Page visits: 4457

Time of last update: 2022-08-08 15:05:49

Author of last update: Jstuelk