sspE

sspE
168

small acid-soluble spore protein (major gamma-type SASP)

locus
BSU_08660
Molecular weight
9.13 kDa
pI
8.94
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (major gamma-type SASP)
essential
no
synonyms
sspE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5853

This gene is a member of the following regulons

Gene
Coordinates
937,900  938,154
The protein
Protein family
gamma-type SASP family (single member, according to UniProt)
Structure
[AF|P07784]
Modification
phosphorylated on Arg-16 [pubmed|31221751]
Expression and Regulation
Operons
genes
[gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]-[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]
description
[Pubmed|10463184]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
[protein|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]: repression, in [regulon|protein:BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10463184], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]→[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]

2022-11-22 15:53:17

ghost

32

67265ff3bb89564e24e307e1cd5eb4bb4dbff57c

9C9F76530F9E01DE8E0DFAA748E25E67C55A5D59

genes
[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]-[gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]-[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]
description
[Pubmed|10463184]
regulation
expression is constitutive throughout growth [Pubmed|20971907]
regulatory mechanism
[protein|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]: repression, in [regulon|protein:BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10463184], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|1900507], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]→[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]

2022-11-26 06:07:12

ghost

42

3a7a008cdfb01ec3e3352da847749371e7eede7c

C3DBF827F212448AA1AC6115B8D2A94E11E4693A

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
MGNA-C365 (sspE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2363 NBRP B. subtilis, Japan]
1S112 (no resistance), [Pubmed|3125155], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S112&Search=1S112 BGSC]
1S113 (no resistance), [Pubmed|3125155], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S113&Search=1S113 BGSC]
BKE08660 ([gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTTATCACCTCCACGG,  downstream forward: _UP4_TAATCACTGAAACAGAAAAA
BKK08660 ([gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTTATCACCTCCACGG,  downstream forward: _UP4_TAATCACTGAAACAGAAAAA
References
Reviews
35638784
Original Publications
3106326,1900507,2456528,2497051,11092849,12107147,10463184,23314362,30782632,31221751

25FC6EEC336387285724F75E304B76A2A3E1C056

Page visits: 2926

Time of last update: 2022-11-29 16:15:41

Author of last update: Jstuelk