iolI

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

iolI
168

inosose isomerase, converts 2KMI to 1-keto-D-chiro-inositol

locus
BSU_39680
Molecular weight
31.50 kDa
pI
4.66
Protein length
Gene length
function
myo-inositol catabolism
product
inosose isomerase, converts 2KMI to 1-keto-D-chiro-inositol
essential
no
ec
null
synonyms
iolI, yxdH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1082

This gene is a member of the following regulons

Gene
Coordinates
4,073,974  4,074,810
The protein
Catalyzed reaction/ biological activity
2,4,6/3,5-pentahydroxycyclohexanone --> 2,3,5/4,6-pentahydroxycyclohexanone (according to UniProt)
scyllo-inosose --> scyllo-inosine (according to UniProt)
Protein family
IolI family (single member, according to UniProt)
Structure
[PDB|1L60]
[AF|P42419]
Expression and Regulation
Operons
genes
[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
description
[Pubmed|9226270]
regulation
induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
regulatory mechanism
[protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]: repression, [Pubmed|9887260,9226270], in [regulon|protein:5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9226270], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]→[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]

2022-04-28 01:52:36

ghost

20

4fd092965338ef1511600132442d2247a2693c98

C19E63046F0B412961D2626F72E0308D922D50B2

Biological materials
Mutant
MGNA-B700 (iolI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1699 NBRP B. subtilis, Japan]
BKE39680 ([gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGACTCCCCCATCT,  downstream forward: _UP4_TAATGGATAAAGGAGGGGTG
BKK39680 ([gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGACTCCCCCATCT,  downstream forward: _UP4_TAATGGATAAAGGAGGGGTG
labs
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
[[Ken-ichi Yoshida]], Kobe University, Japan
References
9226270,9887260,18310071

2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126

Page visits: 1099

Time of last update: 2022-05-14 19:22:02

Author of last update: Melvin.boenninger