SubtiWiki SubtiWiki
yheE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yheE
168

unknown

locus
BSU_09760
Molecular weight
8.42 kDa
pI
5.89
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yheE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,050,443  1,050,661
Expression and Regulation
Operons
genes
[gene|2805C6CCB040910A98B1B2A2BB9FC70AE6779517|yheE]
description
[Pubmed|22383849]
Open in new tab

[gene|2805C6CCB040910A98B1B2A2BB9FC70AE6779517|yheE]

2021-11-05 00:13:23

Jstuelk

7

96dc1c40b3001b8413309e41539d182ee7da8705

A766A80CD28400298383A96F2495FD6160DA858E

Biological materials
Mutant
MGNA-A703 (yheE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/703 NBRP B. subtilis, Japan]
BKE09760 ([gene|2805C6CCB040910A98B1B2A2BB9FC70AE6779517|yheE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCTCCTTACATTTGGTA,  downstream forward: _UP4_TAGCTTAGCCTAAACGGCTA
BKK09760 ([gene|2805C6CCB040910A98B1B2A2BB9FC70AE6779517|yheE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCTCCTTACATTTGGTA,  downstream forward: _UP4_TAGCTTAGCCTAAACGGCTA

2805C6CCB040910A98B1B2A2BB9FC70AE6779517

Page visits: 894

Time of last update: 2021-11-04 18:39:47

Author of last update: Bzhu