ydaP

ydaP
168

general stress protein, required for survival of ethanol stress, cold stress (4C) and oxidative stress (superoxide/paraquat), putative pyruvate oxidase

locus
BSU_04340
Molecular weight
62.97 kDa
pI
5.22
Protein length
Gene length
function
unknown
product
putative pyruvate oxidase
essential
no
synonyms
ydaP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0028

This gene is a member of the following regulons

Gene
Coordinates
488,830  490,554
Phenotypes of a mutant
sensitive to ethanol, cold (4C) and superoxide stress (paraquat)
The protein
Protein family
[wiki|TPP enzyme family] (according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
TPP [pubmed|35988322]
Structure
[PDB|4KGD] (the enzyme from Lactobacillus plantarum, 37% identity, 70% similarity) [Pubmed|23748673]
[PDB|1POW] (from ''Lactobacillus Plantarum'', 38% identity)
[AF|P96591]
Paralogous protein(s)
[protein|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS], [protein|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]
Expression and Regulation
Operons
genes
[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]
description
[Pubmed|10220166]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]

2022-11-23 11:56:57

ghost

21

38f54a0a4d2797eb662d510cfdb24f1195d7e121

809C1E798FDCB19B7C3EB708C80F3D7A131B5129

Biological materials
Mutant
MGNA-C115 (ydaP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2113 NBRP B. subtilis, Japan]
GP457 (spc), available in [wiki|Jörg Stülke]'s lab
JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
BKE04340 ([gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACGTATCCTCCTTTTT,  downstream forward: _UP4_TAAAAAAACAGGGGCCCTAA
BKK04340 ([gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACGTATCCTCCTTTTT,  downstream forward: _UP4_TAAAAAAACAGGGGCCCTAA
References
Reviews
35988322
Original Publications
22582280,10220166,23748673,15805528,22730460,31534226

2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7

Page visits: 2358

Time of last update: 2022-12-02 15:26:45

Author of last update: Jstuelk