bsdA

bsdA
168

transcriptional activator of the [gene|8A83E44AFE9A1A635C65E6B526690AF7DA201BE1|bsdB]-[gene|FD23F4C2AFCBFE35A79116C5A707FACD454E4180|bsdC]-[gene|868DC9DE1C9C26C780F4CEAA4185640B5B6B781B|bsdD] operon

locus
BSU_03620
Molecular weight
32.83 kDa
pI
5.99
Protein length
Gene length
function
regulation of resistance to salicylic acid
product
transcriptional activator ([wiki|LysR family])
essential
no
synonyms
bsdA, yclA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0583

This gene is a member of the following regulons

Gene
Coordinates
411,578  412,450
The protein
Catalyzed reaction/ biological activity
transcriptional activation of the ''[gene|8A83E44AFE9A1A635C65E6B526690AF7DA201BE1|bsdB]-[gene|FD23F4C2AFCBFE35A79116C5A707FACD454E4180|bsdC]-[gene|868DC9DE1C9C26C780F4CEAA4185640B5B6B781B|bsdD]'' operon in response to salicylic acid
Protein family
[wiki|LysR family] (according to UniProt)
[wiki|Domains]
[wiki|HTH lysR-type domain] (aa 1-59) (according to UniProt)
Structure
[PDB|2H99] (from Acinetobacter baylyi, 29% identity) [pubmed|19400783]
[AF|P94403]
Biological materials
Mutant
MGNA-C060 (yclA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2058 NBRP B. subtilis, Japan]
BKE03620 ([gene|28D03575FA24525C162E6C161631034568E89622|bsdA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAAAGCGCCTCCTTA,  downstream forward: _UP4_TAAAAGATTTTGTCTTATGA
BKK03620 ([gene|28D03575FA24525C162E6C161631034568E89622|bsdA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAAAGCGCCTCCTTA,  downstream forward: _UP4_TAAAAGATTTTGTCTTATGA
References
17295427,19400783

28D03575FA24525C162E6C161631034568E89622

Page visits: 1391

Time of last update: 2022-11-29 18:50:46

Author of last update: Melvin.boenninger