ydaL

ydaL
168

general stress protein, synthesis of extracellular polysaccharide

locus
BSU_04290
Molecular weight
63.68 kDa
pI
6.68
Protein length
Gene length
function
synthesis of extracellular polysaccharide
product
unknown
essential
no
synonyms
ydaL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5298

This gene is a member of the following regulons

Gene
Coordinates
480,875  482,584
The protein
Protein family
carbohydrate esterase 4 superfamily [Pubmed|27897378]
Structure
[AF|O31487]
[wiki|Localization]
cell membrane [Pubmed|27897378]
Expression and Regulation
Operons
genes
[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]
description
[Pubmed|22383849]
regulation
expressed during stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|22383849], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]→[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]

2022-12-01 23:42:44

Jstuelk

27

b605f66f599d67e539c67d5e096567c2b2e56ae4

80FCF67C03206CFA39A835FC21447D9DDEAF08EF

Biological materials
Mutant
MGNA-C075 (ydaL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2073 NBRP B. subtilis, Japan]
JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
BKE04290 ([gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACGCATAGCAATGTGA,  downstream forward: _UP4_CGAATTTTTAAGGAGAGAAG
BKK04290 ([gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACGCATAGCAATGTGA,  downstream forward: _UP4_CGAATTTTTAAGGAGAGAAG
References
Reviews
28296273
Original Publications
22383849,27897378

28D80C5497AE29A24AD6B9A1A713A2B3915F2CED

Page visits: 1390

Time of last update: 2022-12-06 03:21:28

Author of last update: Bzhu