sspB

sspB
168

small acid-soluble spore protein (major beta-type SASP)

locus
BSU_09750
Molecular weight
6.84 kDa
pI
4.79
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (major beta-type SASP)
essential
no
synonyms
sspB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5852

This gene is a member of the following regulons

Gene
Coordinates
1,050,031  1,050,234
Phenotypes of a mutant
a ''[gene|28F47ADECD376494878AE58B395B3A2616B6B5DF|sspB]'' mutant is sensitive to ionizing radiation [Pubmed|24123749]
a [gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA] [gene|28F47ADECD376494878AE58B395B3A2616B6B5DF|sspB] double mutant is sensitive to blue light-induced DNA damage [pubmed|30054368]
The protein
Protein family
[wiki|Alpha/beta-type SASP family] (according to UniProt)
Structure
[PDB|2Z3X] ([protein|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC] in complex with DNA, 78% identity)
[AF|P04832]
Modification
phosphorylated on Ser-6, Ser-7, and Ser-45 [Pubmed|26381121]
phosphorylated on Arg-65 [pubmed|31221751]
Paralogous protein(s)
[protein|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA], [protein|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC], [protein|AEFA4CE1588C7EC7FCB01312A172093D12B2B206|sspD]
Expression and Regulation
Operons
genes
[gene|28F47ADECD376494878AE58B395B3A2616B6B5DF|sspB]
description
[Pubmed|3009398]
regulation
expressed during sporulation in the forespore ([protein|search|SigG], [wiki|SpoVT]) [Pubmed|15699190,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
additional information
the mRNA half-life is about 13 min [PubMed|24163345]
Open in new tab

[gene|28F47ADECD376494878AE58B395B3A2616B6B5DF|sspB]

2022-12-21 00:43:42

ghost

26

5899d0a33dcc07a3849e862a8be5f1d167f7ef88

7D3FF8EC23D517637FE1A96788BE215FF044D11C

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
1S111 (no resistance), [Pubmed|3087950], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S111&Search=1S111 BGSC]
1S113 (no resistance), [Pubmed|3125155], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S113&Search=1S113 BGSC]
BKE09750 ([gene|28F47ADECD376494878AE58B395B3A2616B6B5DF|sspB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTAAAATCTCCTTTT,  downstream forward: _UP4_TAACAATTCAATATATGGCT
BKK09750 ([gene|28F47ADECD376494878AE58B395B3A2616B6B5DF|sspB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTAAAATCTCCTTTT,  downstream forward: _UP4_TAACAATTCAATATATGGCT
GFP fusion
GP996 (cat, based on pSG1151), available in [wiki|Jörg Stülke]'s lab
References
Reviews
35638784
Original Publications
16707666,1900507,2456528,3009398,11092849,7608092,15458366,19542328,8755877,23064347,3087950,3125155,24163345,24123749,26381121,30054368,30782632,31221751

28F47ADECD376494878AE58B395B3A2616B6B5DF

Page visits: 4144

Time of last update: 2023-02-05 22:06:34

Author of last update: Jstuelk