ydaG

ydaG
168

putative pyridoxamine 5'-phosphate oxidase , general stress protein, required for protection against paraquat stress

locus
BSU_04220
Molecular weight
15.00 kDa
pI
5.195
Protein length
Gene length
function
survival of stress conditions
product
putative pyridoxamine 5'-phosphate oxidase
essential
no
synonyms
ydaG, yzzA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3871 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
473,803  474,225
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[PDB|3DB0] (from Listeria innocua, 43% identity)
[AF|P80238]
Expression and Regulation
Operons
genes
[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
description
[Pubmed|22383849]
Open in new tab

[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]→[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]

2024-04-13 16:36:29

Jstuelk

37

274d05bc99b84129af0dc4c123bf28394b0935e6

27CF20D9A51B37DB84B21F3DD0F0554697F8DAF7

genes
[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
description
[Pubmed|10220166]
regulation
induced under stress conditions ([protein|search|SigB]) [Pubmed|10220166]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|10220166], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]

2024-04-12 18:06:26

ghost

46

75faf45eea88c00b724b27eb678936d51a833958

3DD1524BC6DCA62AD0E50B4446CB41244347266A

genes
[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]-[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]-[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
description
[Pubmed|10220166]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
expression
expression is increased upon depletion of depletion of tRNA maturation factors [gene|57A79AAF00243B5E058FA901D43AA7B55CA33F63|rnpB] or [gene|C40C5D35ED53D343C8200248FCCB010BAB388054|rnz] [pubmed|36840557]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528,10220166], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]→[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]

2024-04-09 16:58:33

Jstuelk

49

0F01F3D4A72C13FC2BD8814FCB16A6972198E29F

A2B50F578CB3D7FDB3773EE82697C8F07A97C986

Biological materials
Mutant
MGNA-C102 (ydaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2100 NBRP B. subtilis, Japan]
BKE04220 ([gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCGAATCACTCCTTTT,  downstream forward: _UP4_TAAAAAATTTGTGTTTTCAG
BKK04220 ([gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCGAATCACTCCTTTT,  downstream forward: _UP4_TAAAAAATTTGTGTTTTCAG
References
10220166,22582280,15805528,23033921

29342783A375260C5DAE920FBF6EC6EFD2D54DDE

Page visits: 3103

Time of last update: 2024-04-16 17:34:28

Author of last update: Jstuelk