yczE

yczE
168

unknown

locus
BSU_03580
Molecular weight
23.17 kDa
pI
10.02
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yczE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2364

This gene is a member of the following regulons

Gene
Coordinates
408,240  408,887
The protein
Structure
[AF|O34927]
Paralogous protein(s)
[protein|199FA65621C241CB27BBC382A4C62A34DCC74570|yyaS]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|294A73C15606178860DC2509B322519B2B010ABD|yczE]
description
(according to [http://dbtbs.hgc.jp/COG/prom/yczE.html DBTBS]) null
Open in new tab

[gene|294A73C15606178860DC2509B322519B2B010ABD|yczE]

2022-11-21 21:50:48

ghost

8

7a9716367199b3b480a4f2f89467e78cc70e9faa

00BA6A32B832656243F809985927D74CEC8617D0

Biological materials
Mutant
BKE03580 ([gene|294A73C15606178860DC2509B322519B2B010ABD|yczE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTGAGGTCCCTTCTTTC,  downstream forward: _UP4_TAAAACAAAGCCGCCTTGGC
BKK03580 ([gene|294A73C15606178860DC2509B322519B2B010ABD|yczE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTGAGGTCCCTTCTTTC,  downstream forward: _UP4_TAAAACAAAGCCGCCTTGGC

294A73C15606178860DC2509B322519B2B010ABD

Page visits: 906

Time of last update: 2022-11-26 20:20:07

Author of last update: Jstuelk