clpX

clpX
168

AAA unfoldase, ATP-dependent Clp protease, ATP-binding subunit (class III heat-shock protein)

locus
BSU_28220
Molecular weight
46.25 kDa
pI
4.64
Protein length
Gene length
function
protein degradation
product
AAA unfoldase, ATP-dependent Clp protease, ATP-binding subunit
essential
no
synonyms
clpX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1219

This gene is a member of the following regulons

Gene
Coordinates
2,884,781  2,886,043
Phenotypes of a mutant
increased thermotolerance due to increased stabiliy of [protein|2C6386E9A63F410558D168798D077DF91590F454|spx] and thus increased expression of ''[gene|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|trxA]'' [Pubmed|24417481]
the mutation suppresses the heat sensitivity of spores overexpressing ''[gene|85DE3CB6CDA61C141C6030367C0A13BB642160B9|cmpA]'' [Pubmed|26387458]
defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827]
The protein
Catalyzed reaction/ biological activity
ATPase/chaperone
Protein family
ClpX chaperone family (with [protein|2A5A080273CB7698DFABB147F4143E90BBCA3B01|clpY], according to UniProt)
[wiki|Domains]
AAA-ATPase [http://pfam.sanger.ac.uk/family?acc=PF07724 PFAM]
Zinc finger [http://pfam.sanger.ac.uk/family?acc=PF06689 PFAM]
Structure
[PDB|1UM8] (from ''Helicobacter pylori'') [Pubmed|14514695]
[AF|P50866]
[wiki|Localization]
cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heat shock, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] [Pubmed|18786145,18689473]
Expression and Regulation
Operons
genes
[gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]
description
[Pubmed|11325926]
regulation
induced by heat stress ([protein|search|CtsR]) [Pubmed|9852015]
regulatory mechanism
[protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR]: repression, [Pubmed|9852015], in [regulon|protein:908DB17A39D518E84977250C55825E77FA02E391|ctsR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8973311], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]

2022-12-21 12:56:07

ghost

31

5e2b40cda08a3510c2ef35902046c624ab3fe2d8

D2F86E6B696247121B02A464AD0553FF86B67526

Biological materials
Mutant
MGNA-B019 (clpX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1018 NBRP B. subtilis, Japan]
GPUG2 (aphA3), available in [wiki|Ulf Gerth]'s and [wiki|Jörg Stülke]'s labs
GP1787 (aphA3), available in [wiki|Jörg Stülke]'s lab
''clpX::kan'', ''clpX::spec'' and ''clpX::cat'' available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab
BKE28220 ([gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCACCCCTTAATC,  downstream forward: _UP4_TAAAGATAAGCACAAACCTC
BKK28220 ([gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCACCCCTTAATC,  downstream forward: _UP4_TAAAGATAAGCACAAACCTC
GFP fusion
C-terminal GFP fusions (both single copy and 2th copy in ''amyE'' locus, also as CFP and YFP variants) available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab
labs
[wiki|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]
References
Reviews
23375660,19680248,17302811,23479438,19609260,26639779,28748186,34410368,34438398
Original Publications
12761164,10809708,9643546,11807061,14679237,18689476,16899079,8973311,19136590,11325926,8973311,9852015,18689473,20525796,15948963,18786145,24417481,24942655,25433860,25866879,14514695,26387458,27669037,29625553,32477307,34181483,34293284,35638827

297F53DAD3351E0C55108DD2C93B78FFB174438C

Page visits: 4767

Time of last update: 2023-02-02 04:11:16

Author of last update: Jstuelk