sdpR

sdpR
168

transcriptional repressor ([wiki|ArsR family]) of the [gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|search|sdpI ]operon

locus
BSU_33790
Molecular weight
10.10 kDa
pI
7.33
Protein length
Gene length
function
regulation of protection against [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]
product
transcriptional regulator ([wiki|ArsR family])
essential
no
synonyms
sdpR, yvbA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0640

This gene is a member of the following regulons

Gene
Coordinates
3,467,054  3,467,326
The protein
Protein family
[wiki|ArsR family]
[wiki|Domains]
[wiki|HTH arsR-type domain] (aa 1-87) (according to UniProt)
Structure
[PDB|2CWE] (from Pyrococcus horikoshii, 34% identity)
[AF|O32242]
Effectors of protein activity
[protein|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI] binds and sequesters [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR] if extracellular [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] is present, this results in induction of the ''[gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]'' operon [Pubmed|16469701]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]
description
[Pubmed|12817086]
regulation
induced by extracellular [protein|search|SdpC] ([protein|search|SdpR]) [Pubmed|16469701]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|16469701], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]: repression, [Pubmed|16469701], in [regulon|protein:29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16469701], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]→[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]

2022-11-17 07:03:38

ghost

22

5d445ea25a72afe4e546a9c2c315acdd558698ea

9D4EA374978198F0CA6504590736099562B4ED12

Biological materials
Mutant
BKE33790 ([gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCGTTTTCTCCTTTAC,  downstream forward: _UP4_TTATGAAGAAAAATATAATT
BKK33790 ([gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCGTTTTCTCCTTTAC,  downstream forward: _UP4_TTATGAAGAAAAATATAATT
References
Reviews
20955377
Original Publications
12817086,16469701,10960106

29A3EC8FB0C763A973273AA14EAEB904847C3002

Page visits: 1719

Time of last update: 2022-11-28 00:25:27

Author of last update: Melvin.boenninger