SubtiWiki SubtiWiki
ycdB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ycdB
168

unknown

locus
BSU_02790
Molecular weight
53.70 kDa
pI
4.56
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ycdB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
300,830  302,248
Expression and Regulation
Operons
genes
[gene|29A76A461E2A4B795B168E0868038302C36D1CE0|ycdB]
description
(according to [http://dbtbs.hgc.jp/COG/prom/ycdB.html DBTBS]) null
Open in new tab

[gene|29A76A461E2A4B795B168E0868038302C36D1CE0|ycdB]

2022-01-18 07:59:58

ghost

2

9125574d3c2dcf5b7915762fd19761799281c126

CA3A1B006BF8E94D211D03117E7DD3AAE8ABACCB

Biological materials
Mutant
MGNA-B979 (ycdB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1978 NBRP B. subtilis, Japan]
BKE02790 (''[gene|29A76A461E2A4B795B168E0868038302C36D1CE0|ycdB]''::''erm'', available in the BGSC, in [wiki|Fabian Commichau]'s, and in [wiki|Jörg Stülke]'s lab) [pubmed|28189581]
BKE02790 ([gene|29A76A461E2A4B795B168E0868038302C36D1CE0|ycdB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCTTAAGTTCCCTC,  downstream forward: _UP4_TGAAACAGCCAAAAGTCACG
BKK02790 ([gene|29A76A461E2A4B795B168E0868038302C36D1CE0|ycdB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCTTAAGTTCCCTC,  downstream forward: _UP4_TGAAACAGCCAAAAGTCACG

29A76A461E2A4B795B168E0868038302C36D1CE0

Page visits: 589

Time of last update: 2022-01-05 01:45:02

Author of last update: Jstuelk