ycdB

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

ycdB
168

unknown

locus
BSU_02790
Molecular weight
53.70 kDa
pI
4.56
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ycdB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
300,830  302,248
The protein
Structure
[AF|O34621]
Expression and Regulation
Operons
genes
[gene|29A76A461E2A4B795B168E0868038302C36D1CE0|ycdB]
description
(according to [http://dbtbs.hgc.jp/COG/prom/ycdB.html DBTBS]) null
Open in new tab

[gene|29A76A461E2A4B795B168E0868038302C36D1CE0|ycdB]

2022-05-14 01:48:21

ghost

6

9125574d3c2dcf5b7915762fd19761799281c126

CA3A1B006BF8E94D211D03117E7DD3AAE8ABACCB

Biological materials
Mutant
MGNA-B979 (ycdB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1978 NBRP B. subtilis, Japan]
BKE02790 (''[gene|29A76A461E2A4B795B168E0868038302C36D1CE0|ycdB]''::''erm'', available in the BGSC, in [wiki|Fabian Commichau]'s, and in [wiki|Jörg Stülke]'s lab) [pubmed|28189581]
BKE02790 ([gene|29A76A461E2A4B795B168E0868038302C36D1CE0|ycdB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCTTAAGTTCCCTC,  downstream forward: _UP4_TGAAACAGCCAAAAGTCACG
BKK02790 ([gene|29A76A461E2A4B795B168E0868038302C36D1CE0|ycdB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCTTAAGTTCCCTC,  downstream forward: _UP4_TGAAACAGCCAAAAGTCACG

29A76A461E2A4B795B168E0868038302C36D1CE0

Page visits: 642

Time of last update: 2022-05-19 16:05:16

Author of last update: Jstuelk