SubtiWiki SubtiWiki
yitU

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yitU
168

5'-nucleotidase, dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate (minor activity)

locus
BSU_11140
Molecular weight
30.48 kDa
pI
4.67
Protein length
Gene length
function
dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate (minor activity)
product
5'-nucleotidase
essential
no
synonyms
yitU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0561

This gene is a member of the following regulons

Gene
Coordinates
1,190,490  1,191,302
The protein
Catalyzed reaction/ biological activity
dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate (minor activity) [Pubmed|26316208]
5-amino-6-(5-phospho-D-ribitylamino)uracil + H2O --> 5-amino-6-(D-ribitylamino)uracil + phosphate (according to UniProt)
Protein family
[wiki|HAD superfamily] (according to UniProt) [Pubmed|26316208]
[wiki|Cof family] (according to UniProt)
Structure
[PDB|1RKQ] (YidA from E. coli, 31% identity)
Expression and Regulation
Operons
genes
[gene|29EFA7585D7B2FD3A2CDBE2F21AB6742980759B4|yitU]-[gene|8A1EEBB7F3CA4ADE6C1D9ADACFC00DCEF29C3304|yizC]
description
[Pubmed|22383849]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [pubmed|30782632], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|29EFA7585D7B2FD3A2CDBE2F21AB6742980759B4|yitU]→[gene|8A1EEBB7F3CA4ADE6C1D9ADACFC00DCEF29C3304|yizC]

2021-11-13 07:27:23

Jstuelk

3

91a882259e9ce11501fff2dd8d76b5cf29596bee

40A008BA43DB09D5A877D364110175189F81FE3C

Biological materials
Mutant
MGNA-B185 (yitU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1184 NBRP B. subtilis, Japan]
BKE11140 ([gene|29EFA7585D7B2FD3A2CDBE2F21AB6742980759B4|yitU]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAGCTCCTTTAACC,  downstream forward: _UP4_TAAAGAAGGTCCGTATTAAT
BKK11140 ([gene|29EFA7585D7B2FD3A2CDBE2F21AB6742980759B4|yitU]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAGCTCCTTTAACC,  downstream forward: _UP4_TAAAGAAGGTCCGTATTAAT
References
26316208,32040605

29EFA7585D7B2FD3A2CDBE2F21AB6742980759B4

Page visits: 903

Time of last update: 2021-12-17 02:32:58

Author of last update: Jstuelk