clpY

clpY
168

two-component ATP-dependent protease, ATPase subunit

locus
BSU_16160
Molecular weight
52.42 kDa
pI
5.31
Protein length
Gene length
function
protein degradation
product
two-component ATP-dependent protease, ATPase subunit
essential
no
synonyms
clpY, hslU, codX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1220

This gene is a member of the following regulons

Gene
Coordinates
1,688,676  1,690,079
Phenotypes of a mutant
impaired in swarming motility [pubmed|29629859]
The protein
Protein family
ClpX chaperone family (with [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX], according to UniProt)
Structure
[PDB|1DO2] (from E. coli, 51% identity) [pubmed|10693812]
[AF|P39778]
Expression and Regulation
Operons
genes
[gene|B6062575849EA65BB7B44A9723676885799E2759|trmFO]-[gene|89746E312F20C81BE3CFDFCE7D99B01C375C198B|codV]-[gene|F6B748621B312E0B5A0A0782F3944C3E8112D7A8|clpQ]-[gene|2A5A080273CB7698DFABB147F4143E90BBCA3B01|clpY]-[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]
description
[Pubmed|22383849]
regulation
repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|11331605]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|11331605], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7783641], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the intracellular concentration of CodY is about 2.5 myM (according to [PubMed|20408793])
Open in new tab

[gene|B6062575849EA65BB7B44A9723676885799E2759|trmFO]→[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]

2022-12-29 13:58:05

Jstuelk

45

14a27ac38158bfce7849c72f786e8673bc2ce6b1

5257B6B5AFCAE25607CF5DD2E50F759EF0225538

Biological materials
Mutant
BKE16160 ([gene|2A5A080273CB7698DFABB147F4143E90BBCA3B01|clpY]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCGCCTCAAGTCCTTTC,  downstream forward: _UP4_TGAAAAATTTAATATGAGGA
BKK16160 ([gene|2A5A080273CB7698DFABB147F4143E90BBCA3B01|clpY]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCGCCTCAAGTCCTTTC,  downstream forward: _UP4_TGAAAAATTTAATATGAGGA
References
Reviews
23479438,26639779,34410368
Original Publications
12805205,11179218,11331605,7783641,29629859,10693812,34293284

2A5A080273CB7698DFABB147F4143E90BBCA3B01

Page visits: 2133

Time of last update: 2023-02-02 09:58:07

Author of last update: Jstuelk