mlpA

mlpA
168

metallopeptidase, involved in regulation of protease gene expression

locus
BSU_16710
Molecular weight
45.80 kDa
pI
5.28
Protein length
Gene length
function
control of proteolyticc activity
product
specific processing protease
essential
no
synonyms
mlpA, ymxG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0612

This gene is a member of the following regulons

Gene
Coordinates
1,742,617  1,743,846
Phenotypes of a mutant
fivefold increased levels of proteolytic activity in their growth medium [Pubmed|10666719]
The protein
Protein family
[wiki|Peptidase M16 family] (according to UniProt)
Structure
[PDB|3HDI] (from B. halodurans, 64% identity) [pubmed|19913481]
[AF|Q04805]
Expression and Regulation
Operons
genes
[gene|2AD0F2C0B0957A9E77EF9771D010ED77459B8CC0|mlpA]
description
[Pubmed|8098035]
Open in new tab

[gene|2AD0F2C0B0957A9E77EF9771D010ED77459B8CC0|mlpA]

2023-01-07 07:16:37

ghost

27

821deedace34155609e7e8b43b9e6d2a8485386c

2D39716FE03FD57812E1D874D3ABD5B48FA2446A

Biological materials
Mutant
MGNA-A057 (ymxG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/57 NBRP B. subtilis, Japan]
deletion mutant,  available in [wiki|van Dijl] lab
BKE16710 ([gene|2AD0F2C0B0957A9E77EF9771D010ED77459B8CC0|mlpA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGTTCCTCCTATTC,  downstream forward: _UP4_TAAAAAGGAAAGCCTGCCCC
BKK16710 ([gene|2AD0F2C0B0957A9E77EF9771D010ED77459B8CC0|mlpA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGTTCCTCCTATTC,  downstream forward: _UP4_TAAAAAGGAAAGCCTGCCCC
References
Reviews
10974125,34410368
Original Publications
10666719,10974125,8098035,19913481
Labs working on this gene/protein
[wiki|Jan Maarten van Dijl], Groningen, Netherlands

2AD0F2C0B0957A9E77EF9771D010ED77459B8CC0

Page visits: 1714

Time of last update: 2023-01-30 10:56:29

Author of last update: Jstuelk