yjbO

yjbO
168

similar to pseudouridylate synthase

locus
BSU_11620
Molecular weight
31.32 kDa
pI
6.55
Protein length
Gene length
function
RNA modification
product
putative pseudouridylate synthase
essential
no
synonyms
yjbO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0564

This gene is a member of the following regulons

Gene
Coordinates
1,238,523  1,239,374
The protein
Catalyzed reaction/ biological activity
uridine in RNA --> ψ-uridine in RNA (according to UniProt)
Protein family
[wiki|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
pseudouridine synthase RluA family (with [protein|064AE8CE6D52E35582F90654AA9548963573C05C|yhcT] and [protein|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|ylyB], according to UniProt)
[wiki|Domains]
[wiki|S4 RNA-binding domain] (aa 25-79) (according to UniProt)
Structure
[PDB|1V9F] (RluD from E. coli, 40% identical, aa 64 - 279) [pubmed|15078091]
[AF|O31613]
Paralogous protein(s)
[protein|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|ylyB], [protein|064AE8CE6D52E35582F90654AA9548963573C05C|yhcT]
Expression and Regulation
Operons
genes
[gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]-[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]-[gene|2A2640A0501ECEA44A3C0C4842FAC053FB422A1F|nadF]-[gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]
description
[Pubmed|18067544]
regulation
expressed during exponential growth
Open in new tab

[gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]→[gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]

2022-11-30 18:37:17

Jstuelk

32

c5edd61e714281007d4d9ec99a1efa0cfef63f09

83E46551CBC32AB07130281546FE3D422612C2C3

Biological materials
Mutant
MGNA-B161 (yjbO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1160 NBRP B. subtilis, Japan]
BKE11620 ([gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCGTCCTCAGCGGAAG,  downstream forward: _UP4_GAGAATCATTGATTCTCTCC
BKK11620 ([gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCGTCCTCAGCGGAAG,  downstream forward: _UP4_GAGAATCATTGATTCTCTCC
References
18067544,15078091

2AECDA9C4D0E704976B9E2168722EC80FE7A256D

Page visits: 1225

Time of last update: 2022-12-08 05:36:51

Author of last update: Melvin.boenninger