yerI

yerI
168

unknown

locus
BSU_06640
Molecular weight
39.18 kDa
pI
4.87
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yerI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2334

This gene is a member of the following regulons

Gene
Coordinates
724,987  725,997
The protein
Protein family
pseudomonas-type thrB family (single member, according to UniProt)
Structure
[PDB|6EF6] (from Mycobacterium smegmatis, corresponds to aa 17 ... 286, 25% identity) [pubmed|30361441]
[AF|O34640]
Expression and Regulation
Operons
genes
[gene|2AF5F4142F3459A651FCB4057D6B92B9C1D76C6D|yerI]
description
[pubmed|22383849]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|2AF5F4142F3459A651FCB4057D6B92B9C1D76C6D|yerI]

2022-03-10 21:24:51

Bzhu

6

a56668cf0046c0880007d3ea7566d21e0aa1c213

FFAD73287358DCF651625682C4826AFB98332AEA

Biological materials
Mutant
MGNA-A927 (yerI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/927 NBRP B. subtilis, Japan]
BKE06640 ([gene|2AF5F4142F3459A651FCB4057D6B92B9C1D76C6D|yerI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTCATTGCTATAGA,  downstream forward: _UP4_TAGATAGAAAAAGCCAATGG
BKK06640 ([gene|2AF5F4142F3459A651FCB4057D6B92B9C1D76C6D|yerI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTCATTGCTATAGA,  downstream forward: _UP4_TAGATAGAAAAAGCCAATGG
References
20817675,30361441

2AF5F4142F3459A651FCB4057D6B92B9C1D76C6D

Page visits: 879

Time of last update: 2022-06-27 03:21:40

Author of last update: Jstuelk