SubtiWiki SubtiWiki
yfmQ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfmQ
168

unknown

locus
BSU_07380
Molecular weight
16.72 kDa
pI
7.17
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yfmQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
811,569  812,015
The protein
[wiki|Localization]
membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|2B40EE6CFFDC854976A0ED5FB6B0DD7D53CFF257|yfmQ]
description
[Pubmed|22383849]
Open in new tab

[gene|2B40EE6CFFDC854976A0ED5FB6B0DD7D53CFF257|yfmQ]

2021-11-15 01:01:42

Jstuelk

3

4bf007331f6f66f4fea67ac386a6f814a5f228a8

DA5DF95A5D9BEE08F9BADC4D5E662528FFD65617

Biological materials
Mutant
MGNA-C235 (yfmQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2233 NBRP B. subtilis, Japan]
BKE07380 ([gene|2B40EE6CFFDC854976A0ED5FB6B0DD7D53CFF257|yfmQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTTCATCATCTCCGTT,  downstream forward: _UP4_TAAACAGGAAAGTGAAAGAC
BKK07380 ([gene|2B40EE6CFFDC854976A0ED5FB6B0DD7D53CFF257|yfmQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTTCATCATCTCCGTT,  downstream forward: _UP4_TAAACAGGAAAGTGAAAGAC

2B40EE6CFFDC854976A0ED5FB6B0DD7D53CFF257

Page visits: 799

Time of last update: 2021-12-29 17:09:39

Author of last update: Melvin.boenninger