yfhL

yfhL
168

general stress protein, important for survival at low temperature (4C) and during ethanol stress

locus
BSU_08580
Molecular weight
11.86 kDa
pI
11.02
Protein length
Gene length
product
resistence protein (against toxic peptide [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC])
essential
no
synonyms
yfhL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5658

This gene is a member of the following regulons

Gene
Coordinates
929,406  929,738
The protein
Structure
[AF|O31580]
Paralogous protein(s)
[protein|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB], [protein|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|893103B8E6163A4B403CA136A92BA3EA66DC3802|yfhK]-[gene|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|yfhL]-[gene|ED478E2C37F2AD8BF06251B52511287EDB91C9EE|yfhM]
description
[Pubmed|10913081]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|10913081,15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|10913081,15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9987136], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab

[gene|893103B8E6163A4B403CA136A92BA3EA66DC3802|yfhK]→[gene|ED478E2C37F2AD8BF06251B52511287EDB91C9EE|yfhM]

2022-11-29 00:09:45

Bzhu

22

5527a2889122b32c68f7cd90d67b08eea6544a9e

B88EAFEB7F884F08BE6A90D82989FAD011056950

Biological materials
Mutant
MGNA-C364 (yfhL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2362 NBRP B. subtilis, Japan]
BKE08580 ([gene|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|yfhL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCATCATCTCCTTTCT,  downstream forward: _UP4_ACGCACAGTCAAGGAGGAGA
BKK08580 ([gene|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|yfhL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCATCATCTCCTTTCT,  downstream forward: _UP4_ACGCACAGTCAAGGAGGAGA
References
16629676,10913081,15805528,9987136

2B7F65B145005A8ADD2A278E3EA5A52DF162C837

Page visits: 2186

Time of last update: 2022-12-02 02:13:51

Author of last update: Melvin.boenninger