SubtiWiki SubtiWiki
yxkC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yxkC
168

unknown

locus
BSU_38850
Molecular weight
22.00 kDa
pI
9.292
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yxkC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,989,232  3,989,873
The protein
[wiki|Domains]
[wiki|DUF4352] (aa 46 ... 175)(according to UniProt)
Structure
[PDB|4LES] (from B. anthracis, corresponds to aa 79 ... 213, 30% identity)
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9|yxkC]
description
[Pubmed|10746760]
regulation
repressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|12823818], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|15033535], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9|yxkC]

2022-01-20 19:58:35

ghost

2

71530b23ee819a2ea78b3dda9bfae0b4da1c0019

D4F8B0F587E498AA0C8A02EB8DDF27ED423FCCB5

Biological materials
Mutant
MGNA-B737 (yxkC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1736 NBRP B. subtilis, Japan]
BKE38850 (''[gene|2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9|yxkC]''::''erm'', available in the BGSC and in [wiki|Jörg Stülke]'s lab) [pubmed|28189581]
GP1824 (''[gene|2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9|yxkC]''::''erm'', available in [wiki|Jörg Stülke]'s lab)
BKE38850 ([gene|2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9|yxkC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGTTACGTTGAT,  downstream forward: _UP4_TAACAGCTAACAAGGGTGCC
BKK38850 ([gene|2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9|yxkC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGTTACGTTGAT,  downstream forward: _UP4_TAACAGCTAACAAGGGTGCC
References
15033535,12823818,18957862,18763711,10746760,23033921

2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9

Page visits: 1769

Time of last update: 2022-01-20 22:27:37

Author of last update: Jstuelk